PBS EOC Review

Master forensic science and biology concepts with this review worksheet!

Polygraph Review ANSWER THESE QUESTIONS BELOW:1) What is a polygraph?2) What physiological responses are measured during a polygraph test?3) Why is it important to establish baselines during a polygraph test?4) Look at the polygraph above. Which question might be a lie?5) What information in the polygraph would indicate lying? Fingerprinting Review Identify each fingerprint as loop, whorl, arch or tented arch. whorl tented arch loop arch Blood Typing Identify each blood type using the information provided. B AB O A Blood Spatter Analysis Use the images below to answer the questions that followIMAGE 1:IMAGE 2:QUESTIONS:1) Look at image #1 and explain how the first blood spatter would have been created.2) Look at image #2 and identify which drop would have been dropped from the lowest height. Blood Components Function Match Up Match up the terms to their function Erythrocytes To carry oxygen from the lungs to the body, remove carbon dioxide and wastes Thrombocytes They help form blood clots to slow or stop bleeding and to help wounds heal Leukocytes Defends the body against infection and disease by ingesting foreign materials Plasma The fluid part of blood that transports blood cells Height Blood Determination Graph Look at the graph below showing you data of the diameter of blood when dropped from varying heights. Answer the questions below.1) What size blood drop would be created if dropped from 200 cm high?2) A blood spatter of 18mm if recorded from the crime scene. At what height would it have been dropped from? Glaister's Equation A body was found at 1:45pm on a Friday. The measured rectal temperature was 87°F. What is the estimated time of death? Experimental Design ReviewTurtles lay eggs in holes that they dig in the ground. The temperature that eggs are incubated at determines whether the offspring are male or female. Warmer temperatures lead to more females. The normal soil temperature is 35C.Use the data table to identify the constant, control group, experimental group, IV, and DV. Based on the experiment above put the items into the correct category. Control Eggs incubated at 35 C Constants (3) pH of Water Wind Speed Sand Color Independent Variable Temperature eggs are incubated at Dependent Variable Number of Females Hatched Experimental Group Eggs incubated at 25, 30, 40, and 45 C Use the pedigree below to answer the questions that follow. The pedigree above follows a recessive disorder like sickle cell anemia. Use "h" as your genotype letter.1) The sex of individual III-1 is male2) The sex of individual II-1 is female3) The genotype of individual II-7 is hh4) The genotype of individual II-2 is Hh5) The genotype of individual IV-7 is Hh6) The genotype of individual III-6 is either HH or Hh7) What is the probability (% chance) the next baby that individuals II-3 and II-4 have will be affected by the disorder? 25%8) If individual IV-4 has a child with a heterzygous individual, what is the chance that the child will be affected? 50% Matching Match the term with the correct definition Heterozygous two different alleles, a hybrid (Tt) Heredity The passing of characteristics from parent to offspring Genotype The type of genes or alleles present in an organism Dominant The type of gene that always shows even in the presence of a recessive allele Homozygous Two alleles of the same form that makes up a genotype, pure breed (TT or tt) Recessive For of a gene only expressed in a homozygous state (hidden allele) Phenotype An organism's physical appearance Gene A segment of DNA located on a chromosome that codes for a particular protein Punnett Square Practice Both parents are tall (dominant allele). T T T TT TT T TT TT What is the percentage that their offspring will be short? One parent is heterozygous for their brown eyes while the other is homozygous for blue. Complete the cross and find the offspring. B b Bb bb Bb bb What are the chances that the parents will have a child with blue eyes? For each genotype, indicate whether it is heterozygous (HE) or homozygous (HO) Genotype HE AA HO Ee HE Hh HE LL HO Translation Practice:Use the chart below to answer the questions. TTTATTACGGCCATCAATCGTACGGA1) The complementary DNA strand for the sequence above is AAATAATGCCGGTAGTTAGCATGCCT2) The complementary RNA strand for the same sequence is AAAUAAUGCCGGUAGUUAGCAUGCCU3) The start codon is AUG4) The first three amino acids after the start codon are (use the universal code table above) pro val val Karyotype Review Look at the karyotype and answer the questions below.1) What is a karyotype?2) Is this person a male or female?3) What is the chromosomal abnormality present and what is the diagnosis you would make for this person? HIPPA Review Provide a scenario in which HIPPA was violated. Explain specifically what the violation entailed. Testing in the Office Fill in the information regarding testing of organs during a physical. Exam Type Key Tests What does it involve Ear Eye Skin Nose Throat Heart Lungs Heart Diagram Labeling Labels the major parts of the heart. aorta pulmonary artery pulmonary veins superior vena cava left atrium right atrium left ventricle right ventricle mitral valve tricuspid valve